Warning message

Unable to determine the Marked-up Sequence for this

PvSNP1000p62248 454 Sequencing Reads

Overview
NamePvSNP1000p62248 454 Sequencing Reads
Unique NamePv09sc01000p62248_454
TypeGenetic Marker
Marker Type
Source VariantPvSNP1000p62248 (sequence_variant)
Source SpeciesPhaseolus vulgaris (Dry Bean)
Alignments
This genetic_marker is found on:
AssemblySequenceStartEndStrand
Pv09scaffold010006224862248
Properties
Property NameValue
AdditionalType454 Sequencing
Sequence
Locations: Pv09scaffold01000: 62248

FASTA Record

The following sequence is that of the supercontig without any variants taken into account.

>Pv09scaffold01000:61998-62496 (Pv09sc01000p62248_454: genetic_marker)
AATGAAAATGAGAATTATGCAGCATATCCCTCACCTATGCTGCAGGATAATCCAATCTCTTGTTATACATTGCTAAGATCTTATGTTCTCTGGGTACAAAAAAAAGTACAAGCAATCTCAAATTAAAGAACAGAAGATTATTTTCTCTTTGCAAGTTTCTCAATCATTAATGTTCATTAACAATATCAAAAAATGGGAGGCTTTTTAGAGGGTCAGAAATAGCTTGCTTTGCACAAATGACCTCACACAGACTCACTCAAGAAACAAGTCTTTTAGCCTTCAATTTGTTTATCCTAGCATGAAAGACTTCAAATTCTGACCAACCAGCTTTACACCATAAAAAGGAAAAGGAACAGAATGTCTACAGAGGGACATCGCCGCGGCTGTACCGATCACGTCCGTTCATTTCCATGAAACCTGAATGCAAGTTTCTTCTCCTCCTACCTTTGTTTGGCCTAGTTCCTCTTCTTCTATGACCTGAATACACCACAAAAATCACA
Relationships

This genetic_marker is is marker of the following sequence_variant feature(s):

Feature NameUnique NameSpeciesType
PvSNP1000p62248Pv09sc01000p62248Phaseolus vulgarissequence_variant